المدة الزمنية 8:34

How PCR is Used to Amplify Specific Genes

بواسطة Study Force
1 411 مشاهدة
0
33
تم نشره في 2021/06/15

https://StudyForce.comhttps://Biology-Forums.com ✔ Ask questions here: https://Biology-Forums.com/index.php?board=33.0 Follow us: ▶ Facebook: https://facebook.com/StudyForcePS/ ▶ Instagram: https://instagram.com/biologyforums/ ▶ Twitter: https://twitter.com/studyforceps Q. Assume you are using PCR to make multiple copies of a gene (shaded in below). DNA containing gene of interest: 3' TATAAAGACTTACAAATTTGTCCCCATTTTGC 5' 5' ATATTTCTGAATGTTTAAACAGGGGTAAAACG 3' Describe the overall process and diagram the results you would obtain for 1, 2 and 3 rounds of PCR replication using the primers, ATGTT and CCATT. STEP 1: Heat the DNA to 95 °C STEP 2: Lower the temperature between 45 to 60 °C and apply the primers. STEP 3: Allow the primers to anneal (stick) to the single strands. STEP 4: The Taq Polymerase adds dNTPs to the open 3' end of the DNA primers PCR proceeds in a series of cycles, or rounds. Each successive round doubles the amount of DNA and thus more than 1 billion copies of a single DNA fragment can be made in just a few hours. The technique of PCR is simple enough to be used by scientists with little training in molecular biology. The supplies necessary for carrying out PCR are available in a kit form that is used in such varied settings as crime laboratories and clinical diagnostic laboratories.

الفئة

عرض المزيد

تعليقات - 2